Change Permissions

If you use ls -l, you will get a list of all of the files in the current directory along with their file permisions such as: drwxr-xr-x. Now what does this mean?

• r –> read

• w –> write

• x –> execute

How do I change this? Use binary:

For example, if I want to be able to rwx, allow people in my group to rw-, and everyone else to have no permissions: 760. The most useful permissions for websites in my experience (you can rwx but everyone else can only read) were:

• if it’s the directory the HTML is being held in: 744

• if it’s the actual HTML (or any external CSS, Javascript files, pictures used on the site, etc.) : 755

• want to change everything in a folder (recursively): chmod -R 755 directory_name OR if you are already inside the directory: chmod 744 *

Need to kill a process?

1. Get PID (process ID) from top

2. type: kill PID

3. doesn’t work? type: kill -9 PID

Want to run a python or R script from the command line?

Bash Script

A text file with commands. Anything you put in command line can be in a script and vice versa. Uses the .sh extension.

#!/bin/bash

First line must always look something like this. “#!” is called a shebang and immediately after (no spaces), put the path to the interpreter. If you don’t know, type: “which bash” in command line.

#running program from its path

#Bob 07/01/2020

Comments to describe what it does, author, date, etc.

name = “Bob”

You can set variables

echo Hello $name !

Like print, it will print stuff after it. Refer to variables with a “$” in front.

pwd

You can put commands in the script.

In the actual command line, to run the script:

./testscript.sh

AKA, look in the current directory to find the script named testscript.sh and run it.

Reading files

Before anthing, make sure you’re in the right directory ! In python, it looks something like this:

import os
os.getcwd()
os.chdir("/Users/Cara/Desktop/")

Using open, various functions can be accomplished including:

• r –> read

• w –> write

• a –> append

#open the file for reading 
infile=open("file_name.txt", "r")

#reads one character
char = infile.read(1)

#reads one line until \n
line = infile.readline()
while line!="": 
  # ... 
  line = infile.readline()

#alternatively, use infile.readlines() to get all lines in a list, with \n at the end of each item 
#OR use infile.read() to get all lines from where you are in the file 

#close the file after you're finished! 
infile.close()

In R, some quick equivalents include:

infile=file("file_name.txt",open="r")
line <-readLines(infile)
close(infile)

To read multiple files into one variable in R with similar names:

#reads all files in current directory with names starting with 5-27
#Here is where it may be helpful to use regex as talked about later!
example_files <- list.files(pattern = "5-27." )

Another tip, if your data has column names with spaces, e.g. Object Area, this can be extremely irritating to work with. Try something like the following to get something with no spaces: Object_Area

file_no_space<- (read_csv("5-27-A1.csv")) %>% select_all(~gsub("\\s+|\\.", "_", .)) 

Reading websites with Python

You need to import the urllib request package!

from urllib import request

url="http://www.uniprot.org/uniprot/A2Z669.fasta"

#request- opens urls
resp = request.urlopen(url) 

#urlopen is used to open url like open is used for files
#returns html as a string - stored in data variable 
data =  resp.read() 

#don't forget to close your request! 
resp.close()

Basics of Regex

• use raw strings in re.compile(), what does that mean? Begin the string with ‘r’ so that backslashes don’t mean escape.

• search returns first match in a match object and to get the matching string you must use group()

• findall returns a list of strings (if 2 or more groups, it will return a list of tupules)

Groups

Groups are great if you want parts of your matching string. You can indicate groups using parenthesis. So, for example, I can create two groups where group 1 contains the start codon and group 2 contains everthing between the start codon and the stop codon. * Unlike regular indexing in python though, groups start at 1 instead of zero.

dna_String = "CAAAAGCGAUGAAAAGGGUAUGUACGUAGGCAACGACGAACACCGAG"
# regular expression object
geneRegex = re.compile(r'(AUG)(((.){3})*)(UAG|UAA|UGA)') #find start codon and then anything after it until stop codon is reached
# match object, if no matches will return none 
geneMatch=geneRegex.search(dna_String)
geneMatch.group(0) # full string

## 'AUGAAAAGGGUAUGUACGUAG'

geneMatch.group(1) # just start codon

## 'AUG'

geneMatch.group(2) # between start and stop codon

## 'AAAAGGGUAUGUACG'

• if you do matchoutput.group(0) or matchoutput.group(), you’ll get the full string

• you can also have groups within groups !

Making your own Character Class

There are character sets aleady available like /d for digit (reminder: the capital versions of these represent the opposite, in this case, /D is anything that isn’t a digit). However, you may need to create your own by using brackets [ ].

dna_String = "CAAAAGCGAUGAAAAGGGUAUGUACGUAGGCAACGACGAACACCGAG"
geneRegex = re.compile(r'AUG([ACGU]{3})*(UAG|UAA|UGA)') #using character class instead of "."
geneMatch=geneRegex.search(dna_String)
geneMatch.group()

## 'AUGAAAAGGGUAUGUACGUAG'

• if you want anything other than what’s in the brackets, use ^ (e.g. r’[^ACGU]’)

• to ignore capital/lowercase, use an extra argument (e.g. re.compile(r’[ACGU]’,re.I))

HTML/CSS

<button onclick="window.location.href='home.html'" id="home"> Home</button>

text-align:center;
margin-right:auto;
margin-left:auto;

.col1 {
  flex: 1;
}

.col2 {
  flex: 2;
}

.flex-grid {
  flex-wrap: wrap;
}

.col3 {
  width:100%;
}

.col3 {
  flex-direction: column;
}

.flex-grid {
  justify-content: space-between;
}

body {
   margin:0;
   padding:0;
}

<link rel="preconnect" href="https://fonts.gstatic.com">
<link href="https://fonts.googleapis.com/css2?family=Amiko&display=swap" rel="stylesheet">

font-family: 'Amiko', sans-serif;

* {
    --pink--: #FE4D9F;
    --lightblue--: #8BE9F0;
    --yellow--: #FECE76;
    --salmon--: #FF7E8C;
    --darkblue--: #5A95CE;
}

.section {
    color: var(--yellow--);
  backgound-color: var(--salmon--);
}

Javascript

test = document.getElementById("test_id").innerHTML

console.log(test)

PHP

print <<<END
    <!DOCTYPE html>
    <html lang="en">
    <head>
      <title> Chocolate Cookies </title>
      <meta charset="UTF-8">
      <meta name = "description" content = "Cookies">
      <meta name="author" content= "Cara Zou">
  <body>
    </body>
    </html>
END;

new_string = "hello"."world";

<?php
ini_set('display_errors', 1);
ini_set('display_startup_errors', 1);
error_reporting(E_ALL);
?>

print_r($_COOKIE);

header("Location: home.php");

real_escape_string($sql_query_var);

SVG

Downloaded an SVG? Trying to find the center after loading into Processing (I totally haven’t spent a ridiculous amount of time on that before…) ? The below function isn’t just for basic shapes like rectangles, ellipses, etc!

shapeMode(CENTER);

Want to change the color of your SVG? Try something like this before using fill, etc. :

flame=loadShape("flame.svg");
flame.disableStyle();
fill(255,129,3);

Sprites

Trying to find sprites? You may have some luck at opengameart.

Trying to share your processing file? Use processing.js or p5js!